The compound, diallyl disulfide, enriched in garlic, prevents the progressiodoxorubicin-induced nephropathy

San Chi Lin; Amarzaya Chagnaadorj; Uyanga Bayarsengee; Ting Kai Leung; Chao Wen Cheng

doi:10.1590/fst.15418

The compound, diallyl disulfide, enriched in garlic, prevents the progressiodoxorubicin-induced nephropathy

San Chi Lin, Amarzaya Chagnaadorj, Uyanga Bayarsengee, Ting Kai Leung, Chao Wen Cheng

Research output: Contribution to journal › Article › peer-review

8 Citations (Scopus)

Abstract

The main medicinal property of garlic is mostly attributed to its organosulfur compounds, of which the oil-soluble diallyl disulfide (DADS) is the principal component of distilled garlic oil. Nuclear factor erythroid 2-related factor 2 (Nrf2) is an important cellular regulator in response to oxidative stress. This study assessed the possible protective effect of DADS on doxorubicin (Dox)-induced nephrotoxicity and its potential regulation of the Nrf2 pathway. Treatment with DADS (200 μM) induced heme oxygenase (HO)-1 and NADPH quinone oxidoreductase 1 (NQO-1) expression in a human proximal tubular cell line. The induction of HO-1 expression was suppressed in Nrf2-silenced cells. In an animal study, pretreatment with DADS relieved Dox-induced albuminuria, increased catalase activity, and reduced the urinary 8-hydroxy-2’-deoxyguanosine level. In addition, DADS ameliorated the severity of glomerulosclerosis and suppressed expressions of fibrotic and inflammatory gene expressions. Our data indicate that DADS, a major component of garlic, showed protective effects of preventing the progression of Dox-induced nephropathy through enhancing Nrf2-mediated antioxidant activity. DADS, a normal constituent of the human diet, merits investigation as a potential antioxidant daily food supplement against free radical-mediated chronic diseases.

Original language	English
Pages (from-to)	1040-1046
Number of pages	7
Journal	Food Science and Technology
Volume	39
Issue number	4
DOIs	https://doi.org/10.1590/fst.15418
Publication status	Published - Oct 1 2019

Keywords

8-Hydroxy-2’-deoxyguanosine
Catalase
Heme oxygenase 1
Nuclear factor erythroid 2-related factor 2
Organosulfur compounds

ASJC Scopus subject areas

Biotechnology
Food Science

UN SDGs

This output contributes to the following UN Sustainable Development Goals (SDGs)

Access to Document

10.1590/fst.15418

Cite this

@article{94167d70d2b44a47aa029569dc438d7b,

title = "The compound, diallyl disulfide, enriched in garlic, prevents the progressiodoxorubicin-induced nephropathy",

abstract = "The main medicinal property of garlic is mostly attributed to its organosulfur compounds, of which the oil-soluble diallyl disulfide (DADS) is the principal component of distilled garlic oil. Nuclear factor erythroid 2-related factor 2 (Nrf2) is an important cellular regulator in response to oxidative stress. This study assessed the possible protective effect of DADS on doxorubicin (Dox)-induced nephrotoxicity and its potential regulation of the Nrf2 pathway. Treatment with DADS (200 μM) induced heme oxygenase (HO)-1 and NADPH quinone oxidoreductase 1 (NQO-1) expression in a human proximal tubular cell line. The induction of HO-1 expression was suppressed in Nrf2-silenced cells. In an animal study, pretreatment with DADS relieved Dox-induced albuminuria, increased catalase activity, and reduced the urinary 8-hydroxy-2{\textquoteright}-deoxyguanosine level. In addition, DADS ameliorated the severity of glomerulosclerosis and suppressed expressions of fibrotic and inflammatory gene expressions. Our data indicate that DADS, a major component of garlic, showed protective effects of preventing the progression of Dox-induced nephropathy through enhancing Nrf2-mediated antioxidant activity. DADS, a normal constituent of the human diet, merits investigation as a potential antioxidant daily food supplement against free radical-mediated chronic diseases.",

keywords = "8-Hydroxy-2{\textquoteright}-deoxyguanosine, Catalase, Heme oxygenase 1, Nuclear factor erythroid 2-related factor 2, Organosulfur compounds",

author = "Lin, {San Chi} and Amarzaya Chagnaadorj and Uyanga Bayarsengee and Leung, {Ting Kai} and Cheng, {Chao Wen}",

note = "Funding Information: Received 15 May, 2018 Accepted 29 Mar., 2019 1Department of Internal Medicine, Taipei Hospital, Ministry of Health and Welfare, New Taipei City, Taiwan 2Graduate Institute of Clinical Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan 3Department of Internal Medicine, Mongolian National University of Medical Sciences, Ulaanbaatar, Mongolia 4Department of Internal Medicine, Shastin Central Hospital in Ulaanbaatar, Ulaanbaatar, Mongolia 5Department of Radiology, Taoyuan General Hospital, Ministry of Health and Welfare, Taoyuan City, Taiwan 6Graduate Institute of Biomedical Materials and Tissue Engineering, College of Biomedical Engineering, Taipei Medical University, Taipei, Taiwan 7College of Health Care and Management, Kainan University, Taoyuan City, Taiwan 8Traditional Herbal Medicine Research Center, Taipei Medical University Hospital, Taipei Medical University, Taipei, Taiwan 9Cell Physiology and Molecular Image Research Center, Wan Fang Hospital, Taipei Medical University, Taipei, Taiwan Funding Information: Funding sources for the work was supported by the Taipei Hospital, Ministry of Health and Welfare (201504). Funding Information: The scrambled constructs and two different Nrf2 short hairpin (sh)RNA reagents were obtained from the National RNAi Core Facility Platform located at the Onstitute of Molecular Biology/Genomic Research Center, Academia Sinica (Taipei, Taiwan), supported by the National Core Facility Program for Biotechnology Grants of the National Science Council (NSC100-2319-B-001-002). HK-2 cells harboring the sequence of Nrf2-KD1-shRNA oligonucleotide 5′-CCGGGCTCCTACTGTGATGTGAAATCTCGAGATTTC ACATCACAGTAGGAGCTTTTT-3′ (TRCN0000007555) and Nrf2-KD2-shRNA oligonucleotide 5′-CCGGCCGGCATTTCACTAAACA CAACTCGAGTTGTGTTTAGT GAAATGCCGGTTTTT-3′ (TRCN0000007558) were used in this study. Transfected cells were selected using 1 μg/mL of puromycin (Onvitrogen, San Diego, CA), and the knockdown efficiency was confirmed by a real-time polymerase chain reaction (PCR). Funding Information: sources for the work was supported by the Taipei Hospital, Ministry of Health and Welfare (201504). Publisher Copyright: {\textcopyright} 2019, Sociedade Brasileira de Ciencia e Tecnologia de Alimentos, SBCTA. All rights reserved.",

year = "2019",

month = oct,

day = "1",

doi = "10.1590/fst.15418",

language = "English",

volume = "39",

pages = "1040--1046",

journal = "Food Science and Technology (Brazil)",

issn = "0101-2061",

publisher = "Sociedade Brasileira de Ciencia e Tecnologia de Alimentos, SBCTA",

number = "4",

}

TY - JOUR

T1 - The compound, diallyl disulfide, enriched in garlic, prevents the progressiodoxorubicin-induced nephropathy

AU - Lin, San Chi

AU - Chagnaadorj, Amarzaya

AU - Bayarsengee, Uyanga

AU - Leung, Ting Kai

AU - Cheng, Chao Wen

N1 - Funding Information: Received 15 May, 2018 Accepted 29 Mar., 2019 1Department of Internal Medicine, Taipei Hospital, Ministry of Health and Welfare, New Taipei City, Taiwan 2Graduate Institute of Clinical Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan 3Department of Internal Medicine, Mongolian National University of Medical Sciences, Ulaanbaatar, Mongolia 4Department of Internal Medicine, Shastin Central Hospital in Ulaanbaatar, Ulaanbaatar, Mongolia 5Department of Radiology, Taoyuan General Hospital, Ministry of Health and Welfare, Taoyuan City, Taiwan 6Graduate Institute of Biomedical Materials and Tissue Engineering, College of Biomedical Engineering, Taipei Medical University, Taipei, Taiwan 7College of Health Care and Management, Kainan University, Taoyuan City, Taiwan 8Traditional Herbal Medicine Research Center, Taipei Medical University Hospital, Taipei Medical University, Taipei, Taiwan 9Cell Physiology and Molecular Image Research Center, Wan Fang Hospital, Taipei Medical University, Taipei, Taiwan Funding Information: Funding sources for the work was supported by the Taipei Hospital, Ministry of Health and Welfare (201504). Funding Information: The scrambled constructs and two different Nrf2 short hairpin (sh)RNA reagents were obtained from the National RNAi Core Facility Platform located at the Onstitute of Molecular Biology/Genomic Research Center, Academia Sinica (Taipei, Taiwan), supported by the National Core Facility Program for Biotechnology Grants of the National Science Council (NSC100-2319-B-001-002). HK-2 cells harboring the sequence of Nrf2-KD1-shRNA oligonucleotide 5′-CCGGGCTCCTACTGTGATGTGAAATCTCGAGATTTC ACATCACAGTAGGAGCTTTTT-3′ (TRCN0000007555) and Nrf2-KD2-shRNA oligonucleotide 5′-CCGGCCGGCATTTCACTAAACA CAACTCGAGTTGTGTTTAGT GAAATGCCGGTTTTT-3′ (TRCN0000007558) were used in this study. Transfected cells were selected using 1 μg/mL of puromycin (Onvitrogen, San Diego, CA), and the knockdown efficiency was confirmed by a real-time polymerase chain reaction (PCR). Funding Information: sources for the work was supported by the Taipei Hospital, Ministry of Health and Welfare (201504). Publisher Copyright: © 2019, Sociedade Brasileira de Ciencia e Tecnologia de Alimentos, SBCTA. All rights reserved.

PY - 2019/10/1

Y1 - 2019/10/1

N2 - The main medicinal property of garlic is mostly attributed to its organosulfur compounds, of which the oil-soluble diallyl disulfide (DADS) is the principal component of distilled garlic oil. Nuclear factor erythroid 2-related factor 2 (Nrf2) is an important cellular regulator in response to oxidative stress. This study assessed the possible protective effect of DADS on doxorubicin (Dox)-induced nephrotoxicity and its potential regulation of the Nrf2 pathway. Treatment with DADS (200 μM) induced heme oxygenase (HO)-1 and NADPH quinone oxidoreductase 1 (NQO-1) expression in a human proximal tubular cell line. The induction of HO-1 expression was suppressed in Nrf2-silenced cells. In an animal study, pretreatment with DADS relieved Dox-induced albuminuria, increased catalase activity, and reduced the urinary 8-hydroxy-2’-deoxyguanosine level. In addition, DADS ameliorated the severity of glomerulosclerosis and suppressed expressions of fibrotic and inflammatory gene expressions. Our data indicate that DADS, a major component of garlic, showed protective effects of preventing the progression of Dox-induced nephropathy through enhancing Nrf2-mediated antioxidant activity. DADS, a normal constituent of the human diet, merits investigation as a potential antioxidant daily food supplement against free radical-mediated chronic diseases.

AB - The main medicinal property of garlic is mostly attributed to its organosulfur compounds, of which the oil-soluble diallyl disulfide (DADS) is the principal component of distilled garlic oil. Nuclear factor erythroid 2-related factor 2 (Nrf2) is an important cellular regulator in response to oxidative stress. This study assessed the possible protective effect of DADS on doxorubicin (Dox)-induced nephrotoxicity and its potential regulation of the Nrf2 pathway. Treatment with DADS (200 μM) induced heme oxygenase (HO)-1 and NADPH quinone oxidoreductase 1 (NQO-1) expression in a human proximal tubular cell line. The induction of HO-1 expression was suppressed in Nrf2-silenced cells. In an animal study, pretreatment with DADS relieved Dox-induced albuminuria, increased catalase activity, and reduced the urinary 8-hydroxy-2’-deoxyguanosine level. In addition, DADS ameliorated the severity of glomerulosclerosis and suppressed expressions of fibrotic and inflammatory gene expressions. Our data indicate that DADS, a major component of garlic, showed protective effects of preventing the progression of Dox-induced nephropathy through enhancing Nrf2-mediated antioxidant activity. DADS, a normal constituent of the human diet, merits investigation as a potential antioxidant daily food supplement against free radical-mediated chronic diseases.

KW - 8-Hydroxy-2’-deoxyguanosine

KW - Catalase

KW - Heme oxygenase 1

KW - Nuclear factor erythroid 2-related factor 2

KW - Organosulfur compounds

UR - http://www.scopus.com/inward/record.url?scp=85076926674&partnerID=8YFLogxK

UR - http://www.scopus.com/inward/citedby.url?scp=85076926674&partnerID=8YFLogxK

U2 - 10.1590/fst.15418

DO - 10.1590/fst.15418

M3 - Article

AN - SCOPUS:85076926674

SN - 0101-2061

VL - 39

SP - 1040

EP - 1046

JO - Food Science and Technology (Brazil)

JF - Food Science and Technology (Brazil)

IS - 4

ER -

The compound, diallyl disulfide, enriched in garlic, prevents the progressiodoxorubicin-induced nephropathy

Abstract

Keywords

ASJC Scopus subject areas

UN SDGs

Access to Document

Other files and links

Fingerprint

The compound, diallyl disulfide, enriched in garlic, prevents the progression of doxorubicin-induced nephropathy

The compound, diallyl disulfide, enriched in garlic, prevents the progression of doxorubicin-induced nephropathy

Cite this

The compound, diallyl disulfide, enriched in garlic, prevents the progressiodoxorubicin-induced nephropathy

Abstract

Keywords

ASJC Scopus subject areas

UN SDGs

Access to Document

Other files and links

Fingerprint

Datasets

The compound, diallyl disulfide, enriched in garlic, prevents the progression of doxorubicin-induced nephropathy

The compound, diallyl disulfide, enriched in garlic, prevents the progression of doxorubicin-induced nephropathy

Cite this