Molecular modulation of expression of prion protein by heat shock

W. C. Shyu, H. J. Harn, K. Saeki, A. Kubosaki, Y. Matsumoto, T. Onodera, C. J. Chen, Y. D. Hsu, Y. H. Chiang

Research output: Contribution to journalArticle

25 Citations (Scopus)

Abstract

Prion diseases (also known as transmissible spongiform encephalopathies) are associated with the conversion of the normal cellular form of the prion protein (PrPC) to an abnormal scrapie-isoform (PrPSc. The conversion of PrPSc to PrPSc is post-translational and is owing to protein conformational change. This has led to the hypothesis that molecular chaperones may be involved in the folding of prion proteins, and hence the disease process. By treating human NT-2 cells with heat-shock stress, we found that both the mRNA levels for prion protein (PrP) and heat shock protein 70 (HSP7O) increased simultaneously after heat treatment. Western-blot analysis of PrP also showed a two-fold increase in PrP protein level 3 after heat treatment. Furthermore, two heat-shock elements (HSEs) were located at the positions of -680 bp (HSE1; GGAACTATTCTTGACATTGCT), and -1653 bp (HSE2; TGAGAACTCAGGAAG) of the rat PrP (RaPrP) gene promoter. Luciferase reporter constructs of the RaPrP promoter with HSE expressed higher luciferase activity (10- to 15-fold) than those constructs without HSE. Electrophoretic gel mobility shift assay (EMSA) and super-shift assay confirmed the interaction of HSE1 and HSE2 with the heat-shock transcription factor-1 (HSTF-1). These results suggest that cellular stress up-regulates both the transcription and translation of PrP through interaction with the HSEs on the PrP gene promoter, resulting in an increase in protein synthesis.

Original languageEnglish
Pages (from-to)1-12
Number of pages12
JournalMolecular Neurobiology
Volume26
Issue number1
Publication statusPublished - Aug 2002
Externally publishedYes

Fingerprint

Shock
Hot Temperature
Prion Diseases
Luciferases
Scrapie
Proteins
Molecular Chaperones
HSP70 Heat-Shock Proteins
Electrophoretic Mobility Shift Assay
Prion Proteins
Genes
Protein Isoforms
Up-Regulation
Western Blotting
Gels
Messenger RNA

Keywords

  • Heat shock
  • Heat-shock element
  • Prion Protein
  • Stress-response protein
  • Transcriptional regulation

ASJC Scopus subject areas

  • Neuroscience(all)
  • Physiology

Cite this

Shyu, W. C., Harn, H. J., Saeki, K., Kubosaki, A., Matsumoto, Y., Onodera, T., ... Chiang, Y. H. (2002). Molecular modulation of expression of prion protein by heat shock. Molecular Neurobiology, 26(1), 1-12.

Molecular modulation of expression of prion protein by heat shock. / Shyu, W. C.; Harn, H. J.; Saeki, K.; Kubosaki, A.; Matsumoto, Y.; Onodera, T.; Chen, C. J.; Hsu, Y. D.; Chiang, Y. H.

In: Molecular Neurobiology, Vol. 26, No. 1, 08.2002, p. 1-12.

Research output: Contribution to journalArticle

Shyu, WC, Harn, HJ, Saeki, K, Kubosaki, A, Matsumoto, Y, Onodera, T, Chen, CJ, Hsu, YD & Chiang, YH 2002, 'Molecular modulation of expression of prion protein by heat shock', Molecular Neurobiology, vol. 26, no. 1, pp. 1-12.
Shyu WC, Harn HJ, Saeki K, Kubosaki A, Matsumoto Y, Onodera T et al. Molecular modulation of expression of prion protein by heat shock. Molecular Neurobiology. 2002 Aug;26(1):1-12.
Shyu, W. C. ; Harn, H. J. ; Saeki, K. ; Kubosaki, A. ; Matsumoto, Y. ; Onodera, T. ; Chen, C. J. ; Hsu, Y. D. ; Chiang, Y. H. / Molecular modulation of expression of prion protein by heat shock. In: Molecular Neurobiology. 2002 ; Vol. 26, No. 1. pp. 1-12.
@article{29e6a31fd9ce4d048ed9525dfea3a9f7,
title = "Molecular modulation of expression of prion protein by heat shock",
abstract = "Prion diseases (also known as transmissible spongiform encephalopathies) are associated with the conversion of the normal cellular form of the prion protein (PrPC) to an abnormal scrapie-isoform (PrPSc. The conversion of PrPSc to PrPSc is post-translational and is owing to protein conformational change. This has led to the hypothesis that molecular chaperones may be involved in the folding of prion proteins, and hence the disease process. By treating human NT-2 cells with heat-shock stress, we found that both the mRNA levels for prion protein (PrP) and heat shock protein 70 (HSP7O) increased simultaneously after heat treatment. Western-blot analysis of PrP also showed a two-fold increase in PrP protein level 3 after heat treatment. Furthermore, two heat-shock elements (HSEs) were located at the positions of -680 bp (HSE1; GGAACTATTCTTGACATTGCT), and -1653 bp (HSE2; TGAGAACTCAGGAAG) of the rat PrP (RaPrP) gene promoter. Luciferase reporter constructs of the RaPrP promoter with HSE expressed higher luciferase activity (10- to 15-fold) than those constructs without HSE. Electrophoretic gel mobility shift assay (EMSA) and super-shift assay confirmed the interaction of HSE1 and HSE2 with the heat-shock transcription factor-1 (HSTF-1). These results suggest that cellular stress up-regulates both the transcription and translation of PrP through interaction with the HSEs on the PrP gene promoter, resulting in an increase in protein synthesis.",
keywords = "Heat shock, Heat-shock element, Prion Protein, Stress-response protein, Transcriptional regulation",
author = "Shyu, {W. C.} and Harn, {H. J.} and K. Saeki and A. Kubosaki and Y. Matsumoto and T. Onodera and Chen, {C. J.} and Hsu, {Y. D.} and Chiang, {Y. H.}",
year = "2002",
month = "8",
language = "English",
volume = "26",
pages = "1--12",
journal = "Molecular Neurobiology",
issn = "0893-7648",
publisher = "Humana Press",
number = "1",

}

TY - JOUR

T1 - Molecular modulation of expression of prion protein by heat shock

AU - Shyu, W. C.

AU - Harn, H. J.

AU - Saeki, K.

AU - Kubosaki, A.

AU - Matsumoto, Y.

AU - Onodera, T.

AU - Chen, C. J.

AU - Hsu, Y. D.

AU - Chiang, Y. H.

PY - 2002/8

Y1 - 2002/8

N2 - Prion diseases (also known as transmissible spongiform encephalopathies) are associated with the conversion of the normal cellular form of the prion protein (PrPC) to an abnormal scrapie-isoform (PrPSc. The conversion of PrPSc to PrPSc is post-translational and is owing to protein conformational change. This has led to the hypothesis that molecular chaperones may be involved in the folding of prion proteins, and hence the disease process. By treating human NT-2 cells with heat-shock stress, we found that both the mRNA levels for prion protein (PrP) and heat shock protein 70 (HSP7O) increased simultaneously after heat treatment. Western-blot analysis of PrP also showed a two-fold increase in PrP protein level 3 after heat treatment. Furthermore, two heat-shock elements (HSEs) were located at the positions of -680 bp (HSE1; GGAACTATTCTTGACATTGCT), and -1653 bp (HSE2; TGAGAACTCAGGAAG) of the rat PrP (RaPrP) gene promoter. Luciferase reporter constructs of the RaPrP promoter with HSE expressed higher luciferase activity (10- to 15-fold) than those constructs without HSE. Electrophoretic gel mobility shift assay (EMSA) and super-shift assay confirmed the interaction of HSE1 and HSE2 with the heat-shock transcription factor-1 (HSTF-1). These results suggest that cellular stress up-regulates both the transcription and translation of PrP through interaction with the HSEs on the PrP gene promoter, resulting in an increase in protein synthesis.

AB - Prion diseases (also known as transmissible spongiform encephalopathies) are associated with the conversion of the normal cellular form of the prion protein (PrPC) to an abnormal scrapie-isoform (PrPSc. The conversion of PrPSc to PrPSc is post-translational and is owing to protein conformational change. This has led to the hypothesis that molecular chaperones may be involved in the folding of prion proteins, and hence the disease process. By treating human NT-2 cells with heat-shock stress, we found that both the mRNA levels for prion protein (PrP) and heat shock protein 70 (HSP7O) increased simultaneously after heat treatment. Western-blot analysis of PrP also showed a two-fold increase in PrP protein level 3 after heat treatment. Furthermore, two heat-shock elements (HSEs) were located at the positions of -680 bp (HSE1; GGAACTATTCTTGACATTGCT), and -1653 bp (HSE2; TGAGAACTCAGGAAG) of the rat PrP (RaPrP) gene promoter. Luciferase reporter constructs of the RaPrP promoter with HSE expressed higher luciferase activity (10- to 15-fold) than those constructs without HSE. Electrophoretic gel mobility shift assay (EMSA) and super-shift assay confirmed the interaction of HSE1 and HSE2 with the heat-shock transcription factor-1 (HSTF-1). These results suggest that cellular stress up-regulates both the transcription and translation of PrP through interaction with the HSEs on the PrP gene promoter, resulting in an increase in protein synthesis.

KW - Heat shock

KW - Heat-shock element

KW - Prion Protein

KW - Stress-response protein

KW - Transcriptional regulation

UR - http://www.scopus.com/inward/record.url?scp=0036700497&partnerID=8YFLogxK

UR - http://www.scopus.com/inward/citedby.url?scp=0036700497&partnerID=8YFLogxK

M3 - Article

VL - 26

SP - 1

EP - 12

JO - Molecular Neurobiology

JF - Molecular Neurobiology

SN - 0893-7648

IS - 1

ER -